GeneFind (Introduction to Programming in Java

```
public class GeneFind
extends Object
```
Compilation: javac GeneFind.java Execution: java GeneFind start stop < input.txt To find a gene in a genome, we scan for the start codon, remember its index, then scan from the next stop codon. If the length of the intervening sequence is a multiple of 3, we have found a gene. % more genomeTiny.txt ATAGATGCATAGCGCATAGCTAGATGTGCTAGCAT % java GeneFind ATG TAG < genomeTiny.txt CATAGCGCA TGC % java GeneFind ATG TAG < genomeVirus.txt CGCCTGCGTCTGTAC TCGAGCGGATCGCTCACAACCAGTCGG AGATTATCAAAAAGGATCTTCACC

Constructors
Constructor and Description
`GeneFind()`

Methods
Modifier and Type	Method and Description
`static void`	`main(String[] args)`

public static void main(String[] args)

Class GeneFind